Review





Similar Products

96
MedChemExpress 17 aag
( A ) Icicle representation of selective hit compounds of the initial single-dose HTS assay depicting peaks of highly correlating inhibitory profiles constituting compound correlation clusters (CCCs). Concentric circles depict levels of correlation as indicated on the figure (from 0 at the center to 1 at the edge). CCC HSP90i composed of <t>the</t> <t>17-AAG</t> and 33 of its analogs is depicted by a blue peak. ( B ) Inhibition footprint (%) obtained for compounds composing the CCC HSP90i . Orange and blue lines represent data corresponding to the 17-AAG and its analogs, respectively. ( C ) Volcano plot representation of the correlation level between compounds constituting the CCCs and the ribosomal eigengene expression values obtained for tested specimens. The horizontal dashed line indicates a P value of 0.05 and vertical dashed lines indicate correlation of 0.2 and −0.2. Orange and blue dots correspond to compounds significantly correlated and inversely correlated (correlation > |0.2|, P < 0.05), respectively. Dark blue diamonds depict compounds from the CCC HSP90i composed of the 17-AAG (indicated by a larger blue diamond) and 33 of its analogs. ( D ) Ribosomal eigengene expression values according to tier 1 (“sensitive” tier) and tier 3 (“resistant” tier) sensitivity groups for 17-AAG (left) and the best analog (right), i.e., presenting the strongest difference between the two groups. Median values are indicated by black lines on each dot plot. P values resulting from the comparison between groups are indicated on the plot. ( E ) Ribosomal eigengene expression values according to tier 1 (sensitive tier, n = 114 cell lines) and tier 3 (resistant tier, n = 98) 17-AAG sensitivity groups determined using data obtained from The Genomics of Drug Sensitivity in Cancer (GDSC) database.
17 Aag, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aag/Tanespimycin/pmc13178563-223-5-6
Average 96 stars, based on 1 article reviews
17 aag - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

99
New England Biolabs acaggaaacgtcgaaccgac aag
( A ) Icicle representation of selective hit compounds of the initial single-dose HTS assay depicting peaks of highly correlating inhibitory profiles constituting compound correlation clusters (CCCs). Concentric circles depict levels of correlation as indicated on the figure (from 0 at the center to 1 at the edge). CCC HSP90i composed of <t>the</t> <t>17-AAG</t> and 33 of its analogs is depicted by a blue peak. ( B ) Inhibition footprint (%) obtained for compounds composing the CCC HSP90i . Orange and blue lines represent data corresponding to the 17-AAG and its analogs, respectively. ( C ) Volcano plot representation of the correlation level between compounds constituting the CCCs and the ribosomal eigengene expression values obtained for tested specimens. The horizontal dashed line indicates a P value of 0.05 and vertical dashed lines indicate correlation of 0.2 and −0.2. Orange and blue dots correspond to compounds significantly correlated and inversely correlated (correlation > |0.2|, P < 0.05), respectively. Dark blue diamonds depict compounds from the CCC HSP90i composed of the 17-AAG (indicated by a larger blue diamond) and 33 of its analogs. ( D ) Ribosomal eigengene expression values according to tier 1 (“sensitive” tier) and tier 3 (“resistant” tier) sensitivity groups for 17-AAG (left) and the best analog (right), i.e., presenting the strongest difference between the two groups. Median values are indicated by black lines on each dot plot. P values resulting from the comparison between groups are indicated on the plot. ( E ) Ribosomal eigengene expression values according to tier 1 (sensitive tier, n = 114 cell lines) and tier 3 (resistant tier, n = 98) 17-AAG sensitivity groups determined using data obtained from The Genomics of Drug Sensitivity in Cancer (GDSC) database.
Acaggaaacgtcgaaccgac Aag, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aag/Q5+Site-Directed+Mutagenesis+Kit/bio_rxiv__64898__2026__03__12__710951-290-20-28
Average 99 stars, based on 1 article reviews
acaggaaacgtcgaaccgac aag - by Bioz Stars, 2026-08
99/100 stars
  Buy from Supplier

86
Jackson Laboratory primer chatcre wildtype forward gca aag aga cct cat ctg tgg a
( A ) Icicle representation of selective hit compounds of the initial single-dose HTS assay depicting peaks of highly correlating inhibitory profiles constituting compound correlation clusters (CCCs). Concentric circles depict levels of correlation as indicated on the figure (from 0 at the center to 1 at the edge). CCC HSP90i composed of <t>the</t> <t>17-AAG</t> and 33 of its analogs is depicted by a blue peak. ( B ) Inhibition footprint (%) obtained for compounds composing the CCC HSP90i . Orange and blue lines represent data corresponding to the 17-AAG and its analogs, respectively. ( C ) Volcano plot representation of the correlation level between compounds constituting the CCCs and the ribosomal eigengene expression values obtained for tested specimens. The horizontal dashed line indicates a P value of 0.05 and vertical dashed lines indicate correlation of 0.2 and −0.2. Orange and blue dots correspond to compounds significantly correlated and inversely correlated (correlation > |0.2|, P < 0.05), respectively. Dark blue diamonds depict compounds from the CCC HSP90i composed of the 17-AAG (indicated by a larger blue diamond) and 33 of its analogs. ( D ) Ribosomal eigengene expression values according to tier 1 (“sensitive” tier) and tier 3 (“resistant” tier) sensitivity groups for 17-AAG (left) and the best analog (right), i.e., presenting the strongest difference between the two groups. Median values are indicated by black lines on each dot plot. P values resulting from the comparison between groups are indicated on the plot. ( E ) Ribosomal eigengene expression values according to tier 1 (sensitive tier, n = 114 cell lines) and tier 3 (resistant tier, n = 98) 17-AAG sensitivity groups determined using data obtained from The Genomics of Drug Sensitivity in Cancer (GDSC) database.
Primer Chatcre Wildtype Forward Gca Aag Aga Cct Cat Ctg Tgg A, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aag/genotyping+primers+standard/pmc13122704-28-0-13
Average 86 stars, based on 1 article reviews
primer chatcre wildtype forward gca aag aga cct cat ctg tgg a - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

86
Jackson Laboratory primer chatcre mutant forward caa aag cgc tct gaa gtt cct
( A ) Icicle representation of selective hit compounds of the initial single-dose HTS assay depicting peaks of highly correlating inhibitory profiles constituting compound correlation clusters (CCCs). Concentric circles depict levels of correlation as indicated on the figure (from 0 at the center to 1 at the edge). CCC HSP90i composed of <t>the</t> <t>17-AAG</t> and 33 of its analogs is depicted by a blue peak. ( B ) Inhibition footprint (%) obtained for compounds composing the CCC HSP90i . Orange and blue lines represent data corresponding to the 17-AAG and its analogs, respectively. ( C ) Volcano plot representation of the correlation level between compounds constituting the CCCs and the ribosomal eigengene expression values obtained for tested specimens. The horizontal dashed line indicates a P value of 0.05 and vertical dashed lines indicate correlation of 0.2 and −0.2. Orange and blue dots correspond to compounds significantly correlated and inversely correlated (correlation > |0.2|, P < 0.05), respectively. Dark blue diamonds depict compounds from the CCC HSP90i composed of the 17-AAG (indicated by a larger blue diamond) and 33 of its analogs. ( D ) Ribosomal eigengene expression values according to tier 1 (“sensitive” tier) and tier 3 (“resistant” tier) sensitivity groups for 17-AAG (left) and the best analog (right), i.e., presenting the strongest difference between the two groups. Median values are indicated by black lines on each dot plot. P values resulting from the comparison between groups are indicated on the plot. ( E ) Ribosomal eigengene expression values according to tier 1 (sensitive tier, n = 114 cell lines) and tier 3 (resistant tier, n = 98) 17-AAG sensitivity groups determined using data obtained from The Genomics of Drug Sensitivity in Cancer (GDSC) database.
Primer Chatcre Mutant Forward Caa Aag Cgc Tct Gaa Gtt Cct, supplied by Jackson Laboratory, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aag/genotyping+primers+standard/pmc13122704-27-0-12
Average 86 stars, based on 1 article reviews
primer chatcre mutant forward caa aag cgc tct gaa gtt cct - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

95
Selleck Chemicals 17 aag
Nuclear PTGES3 directly binds and transcriptionally activates SP1 . a Target identification. Venn diagram displaying the intersection between PTGES3-bound genes (identified by CUT&Tag) and known transcriptional regulators of TGFB1 (retrieved from the TRRUST v2 database). b Peak visualization. Representative Integrative Genomics Viewer (IGV) tracks showing specific PTGES3 enrichment at the SP1 promoter region. c Motif analysis. The specific G-rich motif sequence identified within the PTGES3 binding peak. d Direct binding verification (EMSA). Electrophoretic mobility shift assay with biotinylated SP1 promoter probes and purified PTGES3 protein. Lane 1: Free probe; Lane 2: Probe + Protein (Shift); Lane 3: Probe + Protein + 5 × WT Competitor (Competition); Lane 4: Probe + Protein + 5 × Mutant Competitor (No competition). e ChIP-qPCR. Chromatin immunoprecipitation validating PTGES3 recruitment to the SP1 promoter in Huh7 cells ( n = 3). Cells expressing negative control shRNA (shNC) or PTGES3 -targeting shRNA (sh PTGES3 ) were assayed using non-specific immunoglobulin G (IgG, black bars) or specific anti-PTGES3 antibodies (red bars). f Transcriptional activity. Dual-luciferase reporter assay in Huh7 cells ( n = 3). Cells were co-transfected with reporter plasmids containing either the Wild-Type (WT) or motif-mutated (Mut) SP1 promoter, alongside empty vector (Vector, white bars) or PTGES3 expression plasmids (red bars). Motif mutation completely abolishes PTGES3-mediated activation. g , mRNA regulation. qPCR analysis of SP1 mRNA levels in Huh7 cells ( n = 3). Comparisons are between shNC and sh PTGES3 groups. h Protein regulation. Western blot analysis and quantification of SP1 expression in Huh7 cells ( n = 3). Left panels: knockdown (shNC vs. sh PTGES3 ); Right panels: overexpression (Vector vs. PTGES3 ). i TGF-β secretion. ELISA quantification of TGF-β levels in the supernatant of Huh7 cells ( n = 4). Groups: siNC + Vector (control), si SP1 + Vector ( SP1 knockdown alone), siNC + PTGES3 ( PTGES3 overexpression), and si SP1 + PTGES3 (rescue). j Signaling rescue (si SP1 ). Western blot analysis of PI3K/AKT/mTOR pathway components in Huh7 cells. SP1 silencing (si SP1 + PTGES3 ) reverses pathway activation induced by PTGES3 alone (siNC + PTGES3 ). k Receptor dependency (ITD-1). Western blot analysis of the PI3K/AKT pathway in Huh7 cells treated with the selective TGF-β receptor inhibitor ITD-1 (5 μM). Groups: Vector vs. PTGES3 overexpression in the presence or absence of ITD-1. l HSP90 independence <t>(17-AAG).</t> Western blot analysis in Huh7 cells treated with the HSP90 inhibitor 17-AAG (0.5 μM). Statistical analysis. Data are presented as mean ± SEM. Individual values are superimposed on bars. Significance was determined using two-tailed unpaired Student's t -test (for g, h), Two-way ANOVA with Šídák's post hoc test (for e, f, i). ** P < 0.01, *** P < 0.001, **** P < 0.0001; ns, not significant. Abbreviations: CUT&Tag, Cleavage Under Targets and Tagmentation; IGV, Integrative Genomics Viewer; EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation; qPCR, quantitative polymerase chain reaction; shRNA, short hairpin RNA; IgG, immunoglobulin G; siRNA, small interfering RNA; ELISA, enzyme-linked immunosorbent assay; WT, wild-type; Mut, mutant; PI3K, phosphoinositide 3-kinase; AKT, protein kinase B; mTOR, mechanistic target of rapamycin; TGF-β, transforming growth factor-beta; HSP90, heat shock protein 90; ANOVA, analysis of variance; SEM, standard error of the mean; NC, negative control
17 Aag, supplied by Selleck Chemicals, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aag/Tanespimycin/pmc13018494-312-24-30
Average 95 stars, based on 1 article reviews
17 aag - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

86
Proteostasis Therapeutics 17 aag tanespimycin
Nuclear PTGES3 directly binds and transcriptionally activates SP1 . a Target identification. Venn diagram displaying the intersection between PTGES3-bound genes (identified by CUT&Tag) and known transcriptional regulators of TGFB1 (retrieved from the TRRUST v2 database). b Peak visualization. Representative Integrative Genomics Viewer (IGV) tracks showing specific PTGES3 enrichment at the SP1 promoter region. c Motif analysis. The specific G-rich motif sequence identified within the PTGES3 binding peak. d Direct binding verification (EMSA). Electrophoretic mobility shift assay with biotinylated SP1 promoter probes and purified PTGES3 protein. Lane 1: Free probe; Lane 2: Probe + Protein (Shift); Lane 3: Probe + Protein + 5 × WT Competitor (Competition); Lane 4: Probe + Protein + 5 × Mutant Competitor (No competition). e ChIP-qPCR. Chromatin immunoprecipitation validating PTGES3 recruitment to the SP1 promoter in Huh7 cells ( n = 3). Cells expressing negative control shRNA (shNC) or PTGES3 -targeting shRNA (sh PTGES3 ) were assayed using non-specific immunoglobulin G (IgG, black bars) or specific anti-PTGES3 antibodies (red bars). f Transcriptional activity. Dual-luciferase reporter assay in Huh7 cells ( n = 3). Cells were co-transfected with reporter plasmids containing either the Wild-Type (WT) or motif-mutated (Mut) SP1 promoter, alongside empty vector (Vector, white bars) or PTGES3 expression plasmids (red bars). Motif mutation completely abolishes PTGES3-mediated activation. g , mRNA regulation. qPCR analysis of SP1 mRNA levels in Huh7 cells ( n = 3). Comparisons are between shNC and sh PTGES3 groups. h Protein regulation. Western blot analysis and quantification of SP1 expression in Huh7 cells ( n = 3). Left panels: knockdown (shNC vs. sh PTGES3 ); Right panels: overexpression (Vector vs. PTGES3 ). i TGF-β secretion. ELISA quantification of TGF-β levels in the supernatant of Huh7 cells ( n = 4). Groups: siNC + Vector (control), si SP1 + Vector ( SP1 knockdown alone), siNC + PTGES3 ( PTGES3 overexpression), and si SP1 + PTGES3 (rescue). j Signaling rescue (si SP1 ). Western blot analysis of PI3K/AKT/mTOR pathway components in Huh7 cells. SP1 silencing (si SP1 + PTGES3 ) reverses pathway activation induced by PTGES3 alone (siNC + PTGES3 ). k Receptor dependency (ITD-1). Western blot analysis of the PI3K/AKT pathway in Huh7 cells treated with the selective TGF-β receptor inhibitor ITD-1 (5 μM). Groups: Vector vs. PTGES3 overexpression in the presence or absence of ITD-1. l HSP90 independence <t>(17-AAG).</t> Western blot analysis in Huh7 cells treated with the HSP90 inhibitor 17-AAG (0.5 μM). Statistical analysis. Data are presented as mean ± SEM. Individual values are superimposed on bars. Significance was determined using two-tailed unpaired Student's t -test (for g, h), Two-way ANOVA with Šídák's post hoc test (for e, f, i). ** P < 0.01, *** P < 0.001, **** P < 0.0001; ns, not significant. Abbreviations: CUT&Tag, Cleavage Under Targets and Tagmentation; IGV, Integrative Genomics Viewer; EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation; qPCR, quantitative polymerase chain reaction; shRNA, short hairpin RNA; IgG, immunoglobulin G; siRNA, small interfering RNA; ELISA, enzyme-linked immunosorbent assay; WT, wild-type; Mut, mutant; PI3K, phosphoinositide 3-kinase; AKT, protein kinase B; mTOR, mechanistic target of rapamycin; TGF-β, transforming growth factor-beta; HSP90, heat shock protein 90; ANOVA, analysis of variance; SEM, standard error of the mean; NC, negative control
17 Aag Tanespimycin, supplied by Proteostasis Therapeutics, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aag/17+aag+tanespimycin/pmc13027136-65-16-13
Average 86 stars, based on 1 article reviews
17 aag tanespimycin - by Bioz Stars, 2026-08
86/100 stars
  Buy from Supplier

95
MedChemExpress aag
The abundance of chaperones and their transcription are decreased in senescent fibroblasts. Inhibiting Hsp90 <t>by</t> <t>17‐AAG</t> caused the selective killing of senescent fibroblasts. (A–D) The summarization of protein changes in abundance of TRiC chaperone, Hsp70 family, Hsp90 family, and other chaperones in senescent BJ cells identified by our proteomic profiling. (E) Western blotting confirmed the protein levels of TCP1, Hsp70, and Hsp90 were decreased in senescent BJ and IMR‐90 cells. β‐Actin served as internal control. (F) RT‐PCR confirmed the transcription levels of TCP1, Hsp70, and Hsp90 genes were also decreased in senescent BJ and IMR‐90 cells. The RT‐PCR product of β‐Actin was as internal control. (G) The morphological changes of growing and senescent IMR‐90 cells at the indicated time of 17‐AAG treatment under the light microscopy. The senescent IMR‐90 cells without 17‐AAG treatment were stained with SA‐β‐gal. Cells were imaged at magnification 200×. (H) Inhibiting Hsp90 by 17‐AAG led to the selective killing of senescent IMR‐90 cells in a dose dependent manner. ** p < 0.01 by one‐way ANOVA. (I) The dose–response curves of 17‐AAG on proliferating and senescent BJ cells. *** p < 0.001 by one‐way ANOVA.
Aag, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aag/BPTES/pmc12962871-220-8-12
Average 95 stars, based on 1 article reviews
aag - by Bioz Stars, 2026-08
95/100 stars
  Buy from Supplier

96
MedChemExpress 17 aag inhibitor
The abundance of chaperones and their transcription are decreased in senescent fibroblasts. Inhibiting Hsp90 <t>by</t> <t>17‐AAG</t> caused the selective killing of senescent fibroblasts. (A–D) The summarization of protein changes in abundance of TRiC chaperone, Hsp70 family, Hsp90 family, and other chaperones in senescent BJ cells identified by our proteomic profiling. (E) Western blotting confirmed the protein levels of TCP1, Hsp70, and Hsp90 were decreased in senescent BJ and IMR‐90 cells. β‐Actin served as internal control. (F) RT‐PCR confirmed the transcription levels of TCP1, Hsp70, and Hsp90 genes were also decreased in senescent BJ and IMR‐90 cells. The RT‐PCR product of β‐Actin was as internal control. (G) The morphological changes of growing and senescent IMR‐90 cells at the indicated time of 17‐AAG treatment under the light microscopy. The senescent IMR‐90 cells without 17‐AAG treatment were stained with SA‐β‐gal. Cells were imaged at magnification 200×. (H) Inhibiting Hsp90 by 17‐AAG led to the selective killing of senescent IMR‐90 cells in a dose dependent manner. ** p < 0.01 by one‐way ANOVA. (I) The dose–response curves of 17‐AAG on proliferating and senescent BJ cells. *** p < 0.001 by one‐way ANOVA.
17 Aag Inhibitor, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/aag/Tanespimycin/pmc12907857-248-8-13
Average 96 stars, based on 1 article reviews
17 aag inhibitor - by Bioz Stars, 2026-08
96/100 stars
  Buy from Supplier

Image Search Results


( A ) Icicle representation of selective hit compounds of the initial single-dose HTS assay depicting peaks of highly correlating inhibitory profiles constituting compound correlation clusters (CCCs). Concentric circles depict levels of correlation as indicated on the figure (from 0 at the center to 1 at the edge). CCC HSP90i composed of the 17-AAG and 33 of its analogs is depicted by a blue peak. ( B ) Inhibition footprint (%) obtained for compounds composing the CCC HSP90i . Orange and blue lines represent data corresponding to the 17-AAG and its analogs, respectively. ( C ) Volcano plot representation of the correlation level between compounds constituting the CCCs and the ribosomal eigengene expression values obtained for tested specimens. The horizontal dashed line indicates a P value of 0.05 and vertical dashed lines indicate correlation of 0.2 and −0.2. Orange and blue dots correspond to compounds significantly correlated and inversely correlated (correlation > |0.2|, P < 0.05), respectively. Dark blue diamonds depict compounds from the CCC HSP90i composed of the 17-AAG (indicated by a larger blue diamond) and 33 of its analogs. ( D ) Ribosomal eigengene expression values according to tier 1 (“sensitive” tier) and tier 3 (“resistant” tier) sensitivity groups for 17-AAG (left) and the best analog (right), i.e., presenting the strongest difference between the two groups. Median values are indicated by black lines on each dot plot. P values resulting from the comparison between groups are indicated on the plot. ( E ) Ribosomal eigengene expression values according to tier 1 (sensitive tier, n = 114 cell lines) and tier 3 (resistant tier, n = 98) 17-AAG sensitivity groups determined using data obtained from The Genomics of Drug Sensitivity in Cancer (GDSC) database.

Journal: Science Advances

Article Title: TP53 -mutant AML with ribosomal gene loss exhibits impaired protein translation and sensitivity to HSP90 inhibition

doi: 10.1126/sciadv.aed7122

Figure Lengend Snippet: ( A ) Icicle representation of selective hit compounds of the initial single-dose HTS assay depicting peaks of highly correlating inhibitory profiles constituting compound correlation clusters (CCCs). Concentric circles depict levels of correlation as indicated on the figure (from 0 at the center to 1 at the edge). CCC HSP90i composed of the 17-AAG and 33 of its analogs is depicted by a blue peak. ( B ) Inhibition footprint (%) obtained for compounds composing the CCC HSP90i . Orange and blue lines represent data corresponding to the 17-AAG and its analogs, respectively. ( C ) Volcano plot representation of the correlation level between compounds constituting the CCCs and the ribosomal eigengene expression values obtained for tested specimens. The horizontal dashed line indicates a P value of 0.05 and vertical dashed lines indicate correlation of 0.2 and −0.2. Orange and blue dots correspond to compounds significantly correlated and inversely correlated (correlation > |0.2|, P < 0.05), respectively. Dark blue diamonds depict compounds from the CCC HSP90i composed of the 17-AAG (indicated by a larger blue diamond) and 33 of its analogs. ( D ) Ribosomal eigengene expression values according to tier 1 (“sensitive” tier) and tier 3 (“resistant” tier) sensitivity groups for 17-AAG (left) and the best analog (right), i.e., presenting the strongest difference between the two groups. Median values are indicated by black lines on each dot plot. P values resulting from the comparison between groups are indicated on the plot. ( E ) Ribosomal eigengene expression values according to tier 1 (sensitive tier, n = 114 cell lines) and tier 3 (resistant tier, n = 98) 17-AAG sensitivity groups determined using data obtained from The Genomics of Drug Sensitivity in Cancer (GDSC) database.

Article Snippet: Alvespimicin (Selleckchem), geldanamycin (MedChemExpress), and 17-AAG (MedChemExpress) were used at 1 M for U937 cells (RRID:CVCL_0007) and 500 nM for primary specimens.

Techniques: HTS Assay, Inhibition, Expressing, Comparison

( A ) Heatmap of responses to HSP90 inhibitors (17-AAG, geldanamycin, and alvespimycin). Colors represent z -scores derived from the median inhibitory concentration (IC 50 ) values (scale shown). The bottom annotation indicates specimen subgroup [-3/del(3p) or control AML]. Columns are ordered by unsupervised hierarchical clustering of IC 50 values. ( B ) Correlation between responses to 17-AAG and alvespimycin (Pearson’s r = 0.79). The dashed line indicates least-squares regression. ( C ) Average response to HSP90 inhibitors [avg(HSP90i); mean of rescaled IC 50 values from −1 to 1] according to subgroup [-3/del(3p) versus control AML], TP53 status, and ribosomal eigengene expression (tier 1, low; and tier 3, high). ( D ) Representative Western blots of RPS14, RPL14, RPL29, and α-tubulin (TUBA; loading control) in U937 cells treated for 24 hours with DMSO or HSP90 inhibitors. ( E ) Representative Western blots of RPL29 and TUBA in primary AML cells [(A) to (D): control AML; (E) to (H): -3/del(3p)] treated for 24 hours with DMSO or HSP90 inhibitors. ( F ) Correlations between RPL29 protein levels (normalized to TUBA) and IC 50 values for each HSP90 inhibitor. Pearson’s r values are indicated; dashed lines represent least-squares regression. ( G ) Ex vivo proliferation of primary -3/del(3p) (gray) and control AML (white) following exposure to DMSO, geldanamycin, or alvespimycin. Cell counts were normalized to Fresh (D0) input and expressed as fold change at days 1 and 4 (NS, not significant). ( H ) Ex vivo viability of primary -3/del(3p) (gray) and control AML (white) after treatment, normalized to Fresh (D0), assessed at days 1 and 4.

Journal: Science Advances

Article Title: TP53 -mutant AML with ribosomal gene loss exhibits impaired protein translation and sensitivity to HSP90 inhibition

doi: 10.1126/sciadv.aed7122

Figure Lengend Snippet: ( A ) Heatmap of responses to HSP90 inhibitors (17-AAG, geldanamycin, and alvespimycin). Colors represent z -scores derived from the median inhibitory concentration (IC 50 ) values (scale shown). The bottom annotation indicates specimen subgroup [-3/del(3p) or control AML]. Columns are ordered by unsupervised hierarchical clustering of IC 50 values. ( B ) Correlation between responses to 17-AAG and alvespimycin (Pearson’s r = 0.79). The dashed line indicates least-squares regression. ( C ) Average response to HSP90 inhibitors [avg(HSP90i); mean of rescaled IC 50 values from −1 to 1] according to subgroup [-3/del(3p) versus control AML], TP53 status, and ribosomal eigengene expression (tier 1, low; and tier 3, high). ( D ) Representative Western blots of RPS14, RPL14, RPL29, and α-tubulin (TUBA; loading control) in U937 cells treated for 24 hours with DMSO or HSP90 inhibitors. ( E ) Representative Western blots of RPL29 and TUBA in primary AML cells [(A) to (D): control AML; (E) to (H): -3/del(3p)] treated for 24 hours with DMSO or HSP90 inhibitors. ( F ) Correlations between RPL29 protein levels (normalized to TUBA) and IC 50 values for each HSP90 inhibitor. Pearson’s r values are indicated; dashed lines represent least-squares regression. ( G ) Ex vivo proliferation of primary -3/del(3p) (gray) and control AML (white) following exposure to DMSO, geldanamycin, or alvespimycin. Cell counts were normalized to Fresh (D0) input and expressed as fold change at days 1 and 4 (NS, not significant). ( H ) Ex vivo viability of primary -3/del(3p) (gray) and control AML (white) after treatment, normalized to Fresh (D0), assessed at days 1 and 4.

Article Snippet: Alvespimicin (Selleckchem), geldanamycin (MedChemExpress), and 17-AAG (MedChemExpress) were used at 1 M for U937 cells (RRID:CVCL_0007) and 500 nM for primary specimens.

Techniques: Derivative Assay, Concentration Assay, Control, Expressing, Western Blot, Ex Vivo

( A ) Experimental design of the 17-AAG efficacy study in mice engrafted with -3/del(3p) #1 PDX cells ( n = 5 mice per group; lines indicate treatment time points; BM asp, BM aspiration). ( B ) Body weight follow-up during the 17-AAG efficacy study ( n = 5 mice, means ± SD). ( C ) Dot plot representation of the percentage of human CD45 + cells in BM aspirates performed 3 days before the treatment initiation, after 2 weeks of treatment as well as in total BM and peripheral blood (PB) at sacrifice (dots represent individual mice, means ± SD). ( D ) Representative FACS profiles of human CD45 + engrafted cells in total BM and PB at sacrifice.

Journal: Science Advances

Article Title: TP53 -mutant AML with ribosomal gene loss exhibits impaired protein translation and sensitivity to HSP90 inhibition

doi: 10.1126/sciadv.aed7122

Figure Lengend Snippet: ( A ) Experimental design of the 17-AAG efficacy study in mice engrafted with -3/del(3p) #1 PDX cells ( n = 5 mice per group; lines indicate treatment time points; BM asp, BM aspiration). ( B ) Body weight follow-up during the 17-AAG efficacy study ( n = 5 mice, means ± SD). ( C ) Dot plot representation of the percentage of human CD45 + cells in BM aspirates performed 3 days before the treatment initiation, after 2 weeks of treatment as well as in total BM and peripheral blood (PB) at sacrifice (dots represent individual mice, means ± SD). ( D ) Representative FACS profiles of human CD45 + engrafted cells in total BM and PB at sacrifice.

Article Snippet: Alvespimicin (Selleckchem), geldanamycin (MedChemExpress), and 17-AAG (MedChemExpress) were used at 1 M for U937 cells (RRID:CVCL_0007) and 500 nM for primary specimens.

Techniques:

Nuclear PTGES3 directly binds and transcriptionally activates SP1 . a Target identification. Venn diagram displaying the intersection between PTGES3-bound genes (identified by CUT&Tag) and known transcriptional regulators of TGFB1 (retrieved from the TRRUST v2 database). b Peak visualization. Representative Integrative Genomics Viewer (IGV) tracks showing specific PTGES3 enrichment at the SP1 promoter region. c Motif analysis. The specific G-rich motif sequence identified within the PTGES3 binding peak. d Direct binding verification (EMSA). Electrophoretic mobility shift assay with biotinylated SP1 promoter probes and purified PTGES3 protein. Lane 1: Free probe; Lane 2: Probe + Protein (Shift); Lane 3: Probe + Protein + 5 × WT Competitor (Competition); Lane 4: Probe + Protein + 5 × Mutant Competitor (No competition). e ChIP-qPCR. Chromatin immunoprecipitation validating PTGES3 recruitment to the SP1 promoter in Huh7 cells ( n = 3). Cells expressing negative control shRNA (shNC) or PTGES3 -targeting shRNA (sh PTGES3 ) were assayed using non-specific immunoglobulin G (IgG, black bars) or specific anti-PTGES3 antibodies (red bars). f Transcriptional activity. Dual-luciferase reporter assay in Huh7 cells ( n = 3). Cells were co-transfected with reporter plasmids containing either the Wild-Type (WT) or motif-mutated (Mut) SP1 promoter, alongside empty vector (Vector, white bars) or PTGES3 expression plasmids (red bars). Motif mutation completely abolishes PTGES3-mediated activation. g , mRNA regulation. qPCR analysis of SP1 mRNA levels in Huh7 cells ( n = 3). Comparisons are between shNC and sh PTGES3 groups. h Protein regulation. Western blot analysis and quantification of SP1 expression in Huh7 cells ( n = 3). Left panels: knockdown (shNC vs. sh PTGES3 ); Right panels: overexpression (Vector vs. PTGES3 ). i TGF-β secretion. ELISA quantification of TGF-β levels in the supernatant of Huh7 cells ( n = 4). Groups: siNC + Vector (control), si SP1 + Vector ( SP1 knockdown alone), siNC + PTGES3 ( PTGES3 overexpression), and si SP1 + PTGES3 (rescue). j Signaling rescue (si SP1 ). Western blot analysis of PI3K/AKT/mTOR pathway components in Huh7 cells. SP1 silencing (si SP1 + PTGES3 ) reverses pathway activation induced by PTGES3 alone (siNC + PTGES3 ). k Receptor dependency (ITD-1). Western blot analysis of the PI3K/AKT pathway in Huh7 cells treated with the selective TGF-β receptor inhibitor ITD-1 (5 μM). Groups: Vector vs. PTGES3 overexpression in the presence or absence of ITD-1. l HSP90 independence (17-AAG). Western blot analysis in Huh7 cells treated with the HSP90 inhibitor 17-AAG (0.5 μM). Statistical analysis. Data are presented as mean ± SEM. Individual values are superimposed on bars. Significance was determined using two-tailed unpaired Student's t -test (for g, h), Two-way ANOVA with Šídák's post hoc test (for e, f, i). ** P < 0.01, *** P < 0.001, **** P < 0.0001; ns, not significant. Abbreviations: CUT&Tag, Cleavage Under Targets and Tagmentation; IGV, Integrative Genomics Viewer; EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation; qPCR, quantitative polymerase chain reaction; shRNA, short hairpin RNA; IgG, immunoglobulin G; siRNA, small interfering RNA; ELISA, enzyme-linked immunosorbent assay; WT, wild-type; Mut, mutant; PI3K, phosphoinositide 3-kinase; AKT, protein kinase B; mTOR, mechanistic target of rapamycin; TGF-β, transforming growth factor-beta; HSP90, heat shock protein 90; ANOVA, analysis of variance; SEM, standard error of the mean; NC, negative control

Journal: Molecular Biomedicine

Article Title: Nuclear prostaglandin E synthase 3 promotes hepatocellular carcinoma growth with immunosuppressive macrophage polarization via the SP1/TGF-β axis

doi: 10.1186/s43556-026-00431-6

Figure Lengend Snippet: Nuclear PTGES3 directly binds and transcriptionally activates SP1 . a Target identification. Venn diagram displaying the intersection between PTGES3-bound genes (identified by CUT&Tag) and known transcriptional regulators of TGFB1 (retrieved from the TRRUST v2 database). b Peak visualization. Representative Integrative Genomics Viewer (IGV) tracks showing specific PTGES3 enrichment at the SP1 promoter region. c Motif analysis. The specific G-rich motif sequence identified within the PTGES3 binding peak. d Direct binding verification (EMSA). Electrophoretic mobility shift assay with biotinylated SP1 promoter probes and purified PTGES3 protein. Lane 1: Free probe; Lane 2: Probe + Protein (Shift); Lane 3: Probe + Protein + 5 × WT Competitor (Competition); Lane 4: Probe + Protein + 5 × Mutant Competitor (No competition). e ChIP-qPCR. Chromatin immunoprecipitation validating PTGES3 recruitment to the SP1 promoter in Huh7 cells ( n = 3). Cells expressing negative control shRNA (shNC) or PTGES3 -targeting shRNA (sh PTGES3 ) were assayed using non-specific immunoglobulin G (IgG, black bars) or specific anti-PTGES3 antibodies (red bars). f Transcriptional activity. Dual-luciferase reporter assay in Huh7 cells ( n = 3). Cells were co-transfected with reporter plasmids containing either the Wild-Type (WT) or motif-mutated (Mut) SP1 promoter, alongside empty vector (Vector, white bars) or PTGES3 expression plasmids (red bars). Motif mutation completely abolishes PTGES3-mediated activation. g , mRNA regulation. qPCR analysis of SP1 mRNA levels in Huh7 cells ( n = 3). Comparisons are between shNC and sh PTGES3 groups. h Protein regulation. Western blot analysis and quantification of SP1 expression in Huh7 cells ( n = 3). Left panels: knockdown (shNC vs. sh PTGES3 ); Right panels: overexpression (Vector vs. PTGES3 ). i TGF-β secretion. ELISA quantification of TGF-β levels in the supernatant of Huh7 cells ( n = 4). Groups: siNC + Vector (control), si SP1 + Vector ( SP1 knockdown alone), siNC + PTGES3 ( PTGES3 overexpression), and si SP1 + PTGES3 (rescue). j Signaling rescue (si SP1 ). Western blot analysis of PI3K/AKT/mTOR pathway components in Huh7 cells. SP1 silencing (si SP1 + PTGES3 ) reverses pathway activation induced by PTGES3 alone (siNC + PTGES3 ). k Receptor dependency (ITD-1). Western blot analysis of the PI3K/AKT pathway in Huh7 cells treated with the selective TGF-β receptor inhibitor ITD-1 (5 μM). Groups: Vector vs. PTGES3 overexpression in the presence or absence of ITD-1. l HSP90 independence (17-AAG). Western blot analysis in Huh7 cells treated with the HSP90 inhibitor 17-AAG (0.5 μM). Statistical analysis. Data are presented as mean ± SEM. Individual values are superimposed on bars. Significance was determined using two-tailed unpaired Student's t -test (for g, h), Two-way ANOVA with Šídák's post hoc test (for e, f, i). ** P < 0.01, *** P < 0.001, **** P < 0.0001; ns, not significant. Abbreviations: CUT&Tag, Cleavage Under Targets and Tagmentation; IGV, Integrative Genomics Viewer; EMSA, electrophoretic mobility shift assay; ChIP, chromatin immunoprecipitation; qPCR, quantitative polymerase chain reaction; shRNA, short hairpin RNA; IgG, immunoglobulin G; siRNA, small interfering RNA; ELISA, enzyme-linked immunosorbent assay; WT, wild-type; Mut, mutant; PI3K, phosphoinositide 3-kinase; AKT, protein kinase B; mTOR, mechanistic target of rapamycin; TGF-β, transforming growth factor-beta; HSP90, heat shock protein 90; ANOVA, analysis of variance; SEM, standard error of the mean; NC, negative control

Article Snippet: Inhibitor Treatment: Pathway dependency was validated using Rapamycin (100 nM; Selleck Chemicals, Houston, TX, USA), ITD-1 (5 μM; Cat. No. S6713; Selleck Chemicals), or 17-AAG (0.5 μM; Cat. No. S1141; Selleck Chemicals).

Techniques: Drug discovery, Sequencing, Binding Assay, Electrophoretic Mobility Shift Assay, Purification, Mutagenesis, ChIP-qPCR, Chromatin Immunoprecipitation, Expressing, Negative Control, shRNA, Activity Assay, Luciferase, Reporter Assay, Transfection, Plasmid Preparation, Activation Assay, Western Blot, Knockdown, Over Expression, Enzyme-linked Immunosorbent Assay, Control, Two Tailed Test, Real-time Polymerase Chain Reaction, Small Interfering RNA

The abundance of chaperones and their transcription are decreased in senescent fibroblasts. Inhibiting Hsp90 by 17‐AAG caused the selective killing of senescent fibroblasts. (A–D) The summarization of protein changes in abundance of TRiC chaperone, Hsp70 family, Hsp90 family, and other chaperones in senescent BJ cells identified by our proteomic profiling. (E) Western blotting confirmed the protein levels of TCP1, Hsp70, and Hsp90 were decreased in senescent BJ and IMR‐90 cells. β‐Actin served as internal control. (F) RT‐PCR confirmed the transcription levels of TCP1, Hsp70, and Hsp90 genes were also decreased in senescent BJ and IMR‐90 cells. The RT‐PCR product of β‐Actin was as internal control. (G) The morphological changes of growing and senescent IMR‐90 cells at the indicated time of 17‐AAG treatment under the light microscopy. The senescent IMR‐90 cells without 17‐AAG treatment were stained with SA‐β‐gal. Cells were imaged at magnification 200×. (H) Inhibiting Hsp90 by 17‐AAG led to the selective killing of senescent IMR‐90 cells in a dose dependent manner. ** p < 0.01 by one‐way ANOVA. (I) The dose–response curves of 17‐AAG on proliferating and senescent BJ cells. *** p < 0.001 by one‐way ANOVA.

Journal: Aging Cell

Article Title: Decreased Glucose Metabolism and Declined Chaperones Are Unique Features Required for the Survival of Senescent Fibroblasts and Pyruvate Dehydrogenase Is a Potent Senolytic Target

doi: 10.1111/acel.70434

Figure Lengend Snippet: The abundance of chaperones and their transcription are decreased in senescent fibroblasts. Inhibiting Hsp90 by 17‐AAG caused the selective killing of senescent fibroblasts. (A–D) The summarization of protein changes in abundance of TRiC chaperone, Hsp70 family, Hsp90 family, and other chaperones in senescent BJ cells identified by our proteomic profiling. (E) Western blotting confirmed the protein levels of TCP1, Hsp70, and Hsp90 were decreased in senescent BJ and IMR‐90 cells. β‐Actin served as internal control. (F) RT‐PCR confirmed the transcription levels of TCP1, Hsp70, and Hsp90 genes were also decreased in senescent BJ and IMR‐90 cells. The RT‐PCR product of β‐Actin was as internal control. (G) The morphological changes of growing and senescent IMR‐90 cells at the indicated time of 17‐AAG treatment under the light microscopy. The senescent IMR‐90 cells without 17‐AAG treatment were stained with SA‐β‐gal. Cells were imaged at magnification 200×. (H) Inhibiting Hsp90 by 17‐AAG led to the selective killing of senescent IMR‐90 cells in a dose dependent manner. ** p < 0.01 by one‐way ANOVA. (I) The dose–response curves of 17‐AAG on proliferating and senescent BJ cells. *** p < 0.001 by one‐way ANOVA.

Article Snippet: Doxorubicin, 2‐deoxy‐glucose (2‐DG), CPI‐613, bis‐2‐(5‐phenylacetamido‐1,3,4‐thiadiazol‐2‐yl)ethyl sulfide (BPTES), and 17‐AAG were purchased from MedChemExpress.

Techniques: Western Blot, Control, Reverse Transcription Polymerase Chain Reaction, Light Microscopy, Staining

Inhibiting PDH, GLS1 and Hsp90 by the combination of CPI‐613+BPTES+17‐AAG gave rise to enhanced senolysis on senescent fibroblasts as well as the therapy‐induced senescent tumor cells. (A, B) The effects of CPI‐613+BPTES+17‐AAG combination treatment on proliferating (A) and senescent (B) BJ cells. For the dose of each compound in use, see the results 2.7 section for more details. ** p < 0.01 by Student's t ‐test. (C, D) The effects of CPI‐613+BPTES+17‐AAG combination treatment on proliferating and Dox‐induced senescent lung adenocarcinoma A549 cells. *** p < 0.001 by Student's t ‐test. (E, F) The effects of CPI‐613+BPTES+17‐AAG combination treatment on proliferating and Dox‐induced senescent cervical carcinoma HeLa cells. *** p < 0.001 by Student's t ‐test. (G) The morphological changes of senescent BJ induced by IR, senescent A549 and HeLa cells induced by Dox at the indicated time of CPI‐613+BPTES+17‐AAG treatment under the light microscopy. The senescent cells without treatment were stained with SA‐β‐gal. Cells were imaged at magnification 200×. (H) The schematic summarization of our findings. The activities of TCA cycle and chaperones are reduced in DNA damage induced senescent cells. Co‐inhibiting Hsp90 and TCA cycle with 17‐AAG+CPI‐613+BPTES combination leads to enhanced selective elimination of senescent cells, hinting TCA cycle and glutaminolysis are novel and potent targets for senolysis.

Journal: Aging Cell

Article Title: Decreased Glucose Metabolism and Declined Chaperones Are Unique Features Required for the Survival of Senescent Fibroblasts and Pyruvate Dehydrogenase Is a Potent Senolytic Target

doi: 10.1111/acel.70434

Figure Lengend Snippet: Inhibiting PDH, GLS1 and Hsp90 by the combination of CPI‐613+BPTES+17‐AAG gave rise to enhanced senolysis on senescent fibroblasts as well as the therapy‐induced senescent tumor cells. (A, B) The effects of CPI‐613+BPTES+17‐AAG combination treatment on proliferating (A) and senescent (B) BJ cells. For the dose of each compound in use, see the results 2.7 section for more details. ** p < 0.01 by Student's t ‐test. (C, D) The effects of CPI‐613+BPTES+17‐AAG combination treatment on proliferating and Dox‐induced senescent lung adenocarcinoma A549 cells. *** p < 0.001 by Student's t ‐test. (E, F) The effects of CPI‐613+BPTES+17‐AAG combination treatment on proliferating and Dox‐induced senescent cervical carcinoma HeLa cells. *** p < 0.001 by Student's t ‐test. (G) The morphological changes of senescent BJ induced by IR, senescent A549 and HeLa cells induced by Dox at the indicated time of CPI‐613+BPTES+17‐AAG treatment under the light microscopy. The senescent cells without treatment were stained with SA‐β‐gal. Cells were imaged at magnification 200×. (H) The schematic summarization of our findings. The activities of TCA cycle and chaperones are reduced in DNA damage induced senescent cells. Co‐inhibiting Hsp90 and TCA cycle with 17‐AAG+CPI‐613+BPTES combination leads to enhanced selective elimination of senescent cells, hinting TCA cycle and glutaminolysis are novel and potent targets for senolysis.

Article Snippet: Doxorubicin, 2‐deoxy‐glucose (2‐DG), CPI‐613, bis‐2‐(5‐phenylacetamido‐1,3,4‐thiadiazol‐2‐yl)ethyl sulfide (BPTES), and 17‐AAG were purchased from MedChemExpress.

Techniques: Light Microscopy, Staining

CPI‐613+BPTES+17‐AAG combination treatment reduced the p21 positive senescent cells and alleviated the physical dysfunctions in aged mice. (A) The experimental design for generating aged mice induced by D‐galactose via intraperitoneal injection and the combination treatment in the aged mice. For the dose of each compound in use, see the methods section for more details. (B) Representative images of aging mice on day 5 after the last combination treatment, the dull and shaggy coat hair and wrinkle formation observed in the aged mice were ameliorated in the treated mice. (C, D) Representative images of p21 stained liver, kidney, and lung tissues from aged mice with or without combination treatment and the quantification of p21 positive cells in liver, kidney, and lung tissues. The red arrows indicate the p21 positive cells, the scale bar stands for 30 μm. Data were presented as means ± SD, p value was calculated by two‐tailed Student's t ‐test. (E–G) Spleens dissected from 7 mice with or without combination treatment were displayed. The surface area and weight of spleens from each mouse group were measured and plotted in F‐G. The surface area of each spleen was calculated using the following formula: S = 5 × (0.524 × L × W × T) 2/3 . (H–M) Physical function measurements in aged mice with or without treatment with CPI‐613+BPTES+17‐AAG combination. Changes in body weight (H), food intake (I), grip strength (J), time on the rotarod (K), running distance on the treadmill (L), and treadmill endurance (M) were plotted. Results are shown as box‐and‐whisker plots with the median shown as a line in the middle, whiskers indicate the smallest and largest values. n = 7, 4 female and 3 male. g, gram; KJ, kilojoule; m, meter; N, Newton; s, second. p values were calculated by the two‐sided Welch's t ‐test and displayed on each plot.

Journal: Aging Cell

Article Title: Decreased Glucose Metabolism and Declined Chaperones Are Unique Features Required for the Survival of Senescent Fibroblasts and Pyruvate Dehydrogenase Is a Potent Senolytic Target

doi: 10.1111/acel.70434

Figure Lengend Snippet: CPI‐613+BPTES+17‐AAG combination treatment reduced the p21 positive senescent cells and alleviated the physical dysfunctions in aged mice. (A) The experimental design for generating aged mice induced by D‐galactose via intraperitoneal injection and the combination treatment in the aged mice. For the dose of each compound in use, see the methods section for more details. (B) Representative images of aging mice on day 5 after the last combination treatment, the dull and shaggy coat hair and wrinkle formation observed in the aged mice were ameliorated in the treated mice. (C, D) Representative images of p21 stained liver, kidney, and lung tissues from aged mice with or without combination treatment and the quantification of p21 positive cells in liver, kidney, and lung tissues. The red arrows indicate the p21 positive cells, the scale bar stands for 30 μm. Data were presented as means ± SD, p value was calculated by two‐tailed Student's t ‐test. (E–G) Spleens dissected from 7 mice with or without combination treatment were displayed. The surface area and weight of spleens from each mouse group were measured and plotted in F‐G. The surface area of each spleen was calculated using the following formula: S = 5 × (0.524 × L × W × T) 2/3 . (H–M) Physical function measurements in aged mice with or without treatment with CPI‐613+BPTES+17‐AAG combination. Changes in body weight (H), food intake (I), grip strength (J), time on the rotarod (K), running distance on the treadmill (L), and treadmill endurance (M) were plotted. Results are shown as box‐and‐whisker plots with the median shown as a line in the middle, whiskers indicate the smallest and largest values. n = 7, 4 female and 3 male. g, gram; KJ, kilojoule; m, meter; N, Newton; s, second. p values were calculated by the two‐sided Welch's t ‐test and displayed on each plot.

Article Snippet: Doxorubicin, 2‐deoxy‐glucose (2‐DG), CPI‐613, bis‐2‐(5‐phenylacetamido‐1,3,4‐thiadiazol‐2‐yl)ethyl sulfide (BPTES), and 17‐AAG were purchased from MedChemExpress.

Techniques: Injection, Staining, Two Tailed Test, Whisker Assay